 |
Experimental validation of gene toxicity
Locus tag: |
Bcen2424_4928 |
Replicon: |
NC_008543 |
Organism: |
Burkholderia cenocepacia HI2424 |
Gene IMG OID: |
639696984 |
Could gene be cloned? |
Yes |
Concentration of IPTG leading to complete growth arrest (μM) |
Slightly less growth >=800 |
Toxicity level |
Not toxic |
Bactericidal effect? |
No |
Number of clones tested |
3 |
Left primer |
GACCATGGAACACTTCACCG |
Right primer |
CCAACACAATCTGTGGACAAGT |
E. coli colony growth after induction of gene expression with IPTG:
Cloning of untransferable genes under the control of an inducible promoter:
Genes were amplified from their genome of origin using the primers above and directionally cloned
into the pET-11a vector (Stratagene Santa Clara, CA, USA).
The ligation reactions were transformed into E. coli BL21- Gold(DE3)pLysS cells (Stratagene).
The clones were screened and verified by direct sequencing using primers on the pET-11a vector.
For the expression activation experiment, clones were cultured in LB medium with 100 μg/ml ampicillin
and 34 μg/ml chloramphenicol overnight.
The next day, a portion of each overnight culture was inoculated into fresh medium (20-fold dilution)
and cultured at 37 °C for 2 to 3 hours with 250 rpm shaking. Cells were then diluted 2500-fold,
and 10 microliters of diluted cells of each culture were spotted into a well of 48-well plates
containing LB agar with or without 100, 250, 400, 600 and 800 μM of IPTG.
The plates were incubated overnight at 37 °C, and growth of each clone in the different
IPTG conditions was recorded.
|