Experimental validation of gene toxicity

Locus tag: Bcen2424_4928
Replicon: NC_008543
Organism: Burkholderia cenocepacia HI2424
Gene IMG OID: 639696984
Could gene be cloned? Yes
Concentration of IPTG leading to complete growth arrest (μM) Slightly less growth >=800
Toxicity level Not toxic
Bactericidal effect? No
Number of clones tested 3
Left primer GACCATGGAACACTTCACCG
Right primer CCAACACAATCTGTGGACAAGT


E. coli colony growth after induction of gene expression with IPTG:

Clones IPTG Concentration
no IPTG 250 μM IPTG 800 μM IPTG
#1
6I13
#2
6G17
#3
6G09


Cloning of untransferable genes under the control of an inducible promoter:

Genes were amplified from their genome of origin using the primers above and directionally cloned
into the pET-11a vector (Stratagene Santa Clara, CA, USA).
The ligation reactions were transformed into E. coli BL21- Gold(DE3)pLysS cells (Stratagene).
The clones were screened and verified by direct sequencing using primers on the pET-11a vector.
For the expression activation experiment, clones were cultured in LB medium with 100 μg/ml ampicillin
and 34 μg/ml chloramphenicol overnight.
The next day, a portion of each overnight culture was inoculated into fresh medium (20-fold dilution)
and cultured at 37 °C for 2 to 3 hours with 250 rpm shaking. Cells were then diluted 2500-fold,
and 10 microliters of diluted cells of each culture were spotted into a well of 48-well plates
containing LB agar with or without 100, 250, 400, 600 and 800 μM of IPTG.
The plates were incubated overnight at 37 °C, and growth of each clone in the different
IPTG conditions was recorded.